Journal: eLife

Article Title: Oxytocin signaling in the posterior hypothalamus prevents hyperphagic obesity in mice

doi: 10.7554/eLife.75718

Figure Lengend Snippet:

Article Snippet: Recombinant DNA reagent , AAV9- hSyn-Cre , Addgene , RRID: Addgene_105555-AAV9 , .

Techniques: Recombinant, RNAscope, Multiplex Assay, Software

Journal: Cells

Article Title: Selective Menin Deletion in the Hippocampal CA1 Region Leads to Disruption of Contextual Memory in the MEN1 Conditional Knockout Mouse: Behavioral Restoration and Gain of Function following the Reintroduction of MEN1 Gene.

doi: 10.3390/cells11244019

Figure Lengend Snippet: Figure 2. The transduction of hippocampal neuronal cultures from the MEN1 floxed mice with the virus, pNN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40. (A) Controls with no virus; (i) GFP signal in the absence of virus; (ii) DAPI for nuclear staining; (iii) merge with GFP and DAPI; (B) CKO with virus transduction by Cre AAV9; (i) GFP signal indicating virus transduction in the preparation with the Cre AAV9; (ii) DAPI for nuclear staining; (iii) merge with GFP and DAPI showing overlap in the neurons expressing GFP and DAPI.

Article Snippet: Ready-to-use AAV9 particles produced from pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 (#105540) were ordered from Addgene.

Techniques: Transduction, Virus, Staining, Expressing

Journal: Cells

Article Title: Selective Menin Deletion in the Hippocampal CA1 Region Leads to Disruption of Contextual Memory in the MEN1 Conditional Knockout Mouse: Behavioral Restoration and Gain of Function following the Reintroduction of MEN1 Gene.

doi: 10.3390/cells11244019

Figure Lengend Snippet: Figure 3. In vitro virus transduction of the hippocampal neurons from MEN1 floxed mice in control and CKO groups. (A) Controls with no virus; (i) the expression of DAP for nuclear staining; (ii) GFP signal in the absence of virus; (iii) C-menin showing axoplasmic expression; (iv) merge in controls for GFP and DAPI; (B) CKOs with virus; (i) DAPI for nuclear staining; (ii) GFP signal indicating virus transduction in the preparation with the Cre AAV9; (iii) C-menin signal weaker compared to the controls; (iv) merge in the CKO for GFP and DAPI; (C) summary data, showing the reduction in menin signals as measured by mean gray-to-area ratio in the CKO compared to the controls. Data represent the mean ratio ± SEM. n = 4. Statistical significance (Mann–Whitney U test), * p < 0.05.

Article Snippet: Ready-to-use AAV9 particles produced from pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 (#105540) were ordered from Addgene.

Techniques: In Vitro, Virus, Transduction, Control, Expressing, Staining, MANN-WHITNEY

Journal: Cells

Article Title: Selective Menin Deletion in the Hippocampal CA1 Region Leads to Disruption of Contextual Memory in the MEN1 Conditional Knockout Mouse: Behavioral Restoration and Gain of Function following the Reintroduction of MEN1 Gene.

doi: 10.3390/cells11244019

Figure Lengend Snippet: Figure 4. In vivo virus transduction of the hippocampal CA1 from MEN1 floxed mice in CA1 region of hippocampus and dentate gyrus (DG). (A) Expression of GFP in CA1 in the CKO; (i) the expression of DAPI for nuclear staining in CA1; (ii) the expression of GFP as the marker of virus transduction in the neurons transduced by the AAV9 under the action of synapsin promoter in CA1; (iii) merge in controls with control virus AAV9 GFP and overlap between DAPI and GFP; (B) non-GFP expressing region in dentate gyrus (DG); (i) the expression of DAPI for nuclear staining in DG; (ii) GFP signal in the non-transduced region of hippocampus; (iii) merge for showing the overlap between DAPI and GFP.

Article Snippet: Ready-to-use AAV9 particles produced from pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 (#105540) were ordered from Addgene.

Techniques: In Vivo, Virus, Transduction, Expressing, Staining, Marker, Control

Journal: Cells

Article Title: Selective Menin Deletion in the Hippocampal CA1 Region Leads to Disruption of Contextual Memory in the MEN1 Conditional Knockout Mouse: Behavioral Restoration and Gain of Function following the Reintroduction of MEN1 Gene.

doi: 10.3390/cells11244019

Figure Lengend Snippet: Figure 6. Ectopic expression in the hippocampus of the mice injected with AAV9 under the function of synapsin promoter and GFP as the marker for the virus transduction. (i) The expression of DAPI for nuclear staining; (ii) GFP as the marker of virus transduction in the neurons transduced by the control AAV9 under the action of synapsin promoter; (iii) merge in controls showing overlap between DAPI and GFP.

Article Snippet: Ready-to-use AAV9 particles produced from pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 (#105540) were ordered from Addgene.

Techniques: Expressing, Injection, Marker, Virus, Transduction, Staining, Control

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: Data and Software Availability

Article Snippet: NCBI {"type":"entrez-geo","attrs":{"text":"GSE140309","term_id":"140309"}} GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Software, Staining, Recombinant, DNA Extraction, Binding Assay, Enzyme-linked Immunosorbent Assay, Isolation, Generated, RNA Sequencing Assay, Expressing

Journal: Nature

Article Title: The Gut-Brain Axis Mediates Sugar Preference

doi: 10.1038/s41586-020-2199-7

Figure Lengend Snippet: a-c , Penk -Cre mice were stimulated with 600 mM glucose, and brain slices were analysed for Fos and Penk labelling. Penk neurons were marked by expression of nuclear-localized tdTomato (Ai75D ). b , Low-magnification section of the brainstem (Bregma −7.5 mm) showing Penk expression (red); tissue was counterstained with DAPI (blue), n = 2 independent experiments. Scale bar, 500 μm; cNST, highlighted yellow. c , Sugar-preference neurons are Penk -expressing. Penk neurons labelled with tdTomato (from panel b ) and glucose-activated neurons (Fos-labelled) marked green. Note the high degree of overlap in the merged image. Approximately 85% of sugar-activated cNST neurons are marked by Penk , and ~90% of cNST Penk neurons have sugar-Fos labelling (n = 3 mice). Scale bar, 20 μm. d , The activating DREADD receptor , AAV-DIO-hM3Dq was targeted bilaterally to the cNST of Penk -Cre animals. Mice were then tested for their preference between two flavours for 48 h (PRE). The diagram shows an example using cherry (containing 2 mM AceK) versus grape (with 1 mM AceK). Animals were conditioned and tested using the un-preferred flavour plus the DREADD agonist Clozapine (POST; see ). e , Penk -hM3Dq animals initially prefer the sweeter solution. Remarkably, after associating Clozapine-mediated activation of Penk cNST neurons with the un-preferred flavour, all the Penk -hM3Dq mice significantly switched their preference (PRE = 18.1 ± 2.7 %, POST = 61.1 ± 5.5 %; n = 8 mice, two-sided Mann-Whitney U-Test, p = 1 × 10 −4 ). The experiment was carried out using grape (purple lines) or cherry (red lines) as the initially un-preferred stimuli. f , Mice not expressing the DREADD receptor are unaffected by the presence of Clozapine (PRE = 19.0 ± 3.0 %, POST = 21.4 ± 4.0 %, n = 8 mice); control animals were subjected to the same conditioning and testing as the experimental cohort. Values are mean ± s.e.m.

Article Snippet: For gain of preference experiments, Penk -Cre animals were stereotaxically injected with 300 nl of AAV carrying Cre-dependent activator DREADD (1–2 × 10 13 GC/ml; AAV9 Syn-DIO-hM3Dq-mCherry, Addgene #44361), bilaterally in the cNST.

Techniques: Expressing, Activation Assay, MANN-WHITNEY, Control